deus ex computa
     Skip Navigation Links.


Conserved Amino Acids

Purpose of this program

This program was designed to help a lab mate to find out if an amino acid was conserved in a number of different species that do not have any protein sequence data but do have genomic DNA sequences on the UCSC genome browser site.

insilicase icon This program can be downloaded here.

To use the program first collect the data following the instuction in section A then use the program as shown in section B:

Section A

  1. The program works with coding sequences, while the genome browser is geared to genomic DNA, therefore it's easier to search the web page with the DNA sequence of the exon that contains the AA you are interested in. (See bottom of page for an example.)
  2. Go the UCSC Genome browser 'Blat' page and paste your exon sequence in to the text box and press 'Submit'.
  3. Go throught the pages untill you are at the browser page, scroll down the web page and in the 'Comparative Genomics' section, select the Chain option for the species you want to check and press the 'refresh' button.
  4. Find the track that represents the data and select it, then on the next page select the 'View details of parts of chain within browser window.' link
  5. Finally, scroll down to the section where the alignment between your sequence and species sequence is and copy the whole alignment. (See bottom of page for an example.)

Section B

  • Press the 'Sequence' button and import the file containing the cDNA sequence. The sequence will then appear in the panel
  • Select the start of the open reading frame from the list box at the bottom left of the form or enter it into the text box next to the 'Start codon' label. The ORFs amino acid sequence should now be visible. (Use the scroll bar to navigate along the sequence.)
  • Press the 'Alignment' button and paste the alignment from 'Section A' in to the text box.
  • Press the 'format' button and check formated alignment, changes to this alignment will be ignored. If it is OK press the 'Done' button.
  • Scroll along the sequence to find the AA you are interested in and see if it has been conserved.
  • To reset the mutant sequence press the 'Reset' button.
  • To identify a position, click on the sequence and the information will appear below the scroll bar.

Example data

Sequence exon 3 of ABCC8 to use in Blat search of the UCSC browser

ggtgaccgaatcccaccatctgcacctgtacatgccagccgggatggcgttcatggctgctgtcacctccgtggtctactatcacaacatcgagactt ccaacttccccaagctgctaattg

Alignment of the ABCC8 sequence with Medaka (Japanese killifish)

21648630 ggtgatgaacaccgaccaccttcatctcttcatgccagcattcatgggtttcatagcagc 21648689
<<<<<<<< |||||   |  || |||| || || || | |||||||||    ||||  ||||| || || <<<<<<<<
17448345 ggtgaccgaatcccaccatctgcacctgtacatgccagccgggatggcgttcatggctgc 17448286

21648690 aacaacgtctgtggtttattaccacaacatagagacatccaacttccctaaactgctgct 21648749
<<<<<<<<    || || |||||  || || |||||||| ||||| ||||||||||| || |||||  | <<<<<<<<
17448285 tgtcacctccgtggtctactatcacaacatcgagacttccaacttccccaagctgctaat 17448226

21648750 tg 21648751
<<<<<<<< || <<<<<<<<
17448225 tg 17448224

Full sequence of ABCC8 cDNA
cggggcccggggggcgggggcctgacggccgggccgggcggcggagctgcaagggacaga ggcgcggcaggcgcgcggagccagcggagccagctgagcccgagcccagcccgcgcccgc gccgccatgcccctggccttctgcggcagcgagaaccactcggccgcctaccgggtggac cagggggtcctcaacaacggctgctttgtggacgcgctcaacgtggtgccgcacgtcttc ctactcttcatcaccttccccatcctcttcattggatggggaagtcagagctccaaggtg cacatccaccacagcacatggcttcatttccctgggcacaacctgcggtggatcctgacc ttcatgctgctcttcgtcctggtgtgtgagattgcagagggcatcctgtctgatggggtg accgaatcccaccatctgcacctgtacatgccagccgggatggcgttcatggctgctgtc acctccgtggtctactatcacaacatcgagacttccaacttccccaagctgctaattgcc ctgctggtgtattggaccctggccttcatcaccaagaccatcaagtttgtcaagttcttg gaccacgccatcggcttctcgcagctacgcttctgcctcacagggctgctggtgatcctc tatgggatgctgctcctcgtggaggtcaatgtcatcagggtgaggagatacatcttcttc aagacaccgagggaggtgaagcctcccgaggacctgcaagacctgggggtacgcttcctg cagcccttcgtgaatctgctgtccaaaggcacctactggtggatgaacgccttcatcaag actgcccacaagaagcccatcgacttgcgagccatcgggaagctgcccatcgccatgagg gccctcaccaactaccaacggctctgcgaggcctttgacgcccaggtgcggaaggacatt cagggcactcaaggtgcccgggccatctggcaggcactcagccatgccttcgggaggcgc ctggtcctcagcagcactttccgcatcttggccgacctgctgggcttcgccgggccactg tgcatctttgggatcgtggaccaccttgggaaggagaacgacgtcttccagcccaagaca caatttctcggggtttactttgtctcatcccaagagttccttgccaatgcctacgtctta gctgtgcttctgttccttgccctcctactgcaaaggacatttctgcaagcatcctactat gtggccattgaaactggaattaacttgagaggagcaatacagaccaagatttacaataaa attatgcacctgtccacctccaacctgtccatgggagaaatgactgctggacagatctgt aatctggttgccatcgacaccaatcagctcatgtggtttttcttcttgtgcccaaacctc tgggctatgccagtacagatcattgtgggtgtgattctcctctactacatactcggagtc agtgccttaattggagcagctgtcatcattctactggctcctgtccagtacttcgtggcc accaagctgtctcaggcccagcggagcacactggagtattccaatgagcggctgaagcag accaacgagatgctccgcggcatcaagctgctgaagctgtacgcctgggagaacatcttc cgcacgcgggtggagacgacccgcaggaaggagatgaccagcctcagggcctttgccatc tatacctccatctccattttcatgaacacggccatccccattgcagctgtcctcataact ttcgtgggccacgtcagcttcttcaaagaggccgacttctcgccctccgtggcctttgcc tccctctccctcttccatatcttggtcacaccgctgttcctgctgtccagtgtggtccga tctaccgtcaaagctctagtgagcgtgcaaaagctaagcgagttcctgtccagtgcagag atccgtgaggagcagtgtgccccccatgagcccacacctcagggcccagccagcaagtac caggcggtgcccctcagggttgtgaaccgcaagcgtccagcccgggaggattgtcggggc ctcaccggcccactgcagagcctggtccccagtgcagatggcgatgctgacaactgctgt gtccagatcatgggaggctacttcacgtggaccccagatggaatccccacactgtccaac atcaccattcgtatcccccgaggccagctgactatgatcgtggggcaggtgggctgcggc aagtcctcgctccttctagccgcactgggggagatgcagaaggtctcaggggctgtcttc tggagcagccttcctgacagcgagataggagaggaccccagcccagagcgggagacagcg accgacttggatatcaggaagagaggccccgtggcctatgcttcgcagaaaccatggctg ctaaatgccactgtggaggagaacatcatctttgagagtcccttcaacaaacaacggtac aagatggtcattgaagcctgctctctgcagccagacatcgacatcctgccccatggagac cagacccagattggggaacggggcatcaacctgtctggtggtcaacgccagcgaatcagt gtggcccgagccctctaccagcacgccaacgttgtcttcttggatgaccccttctcagct ctggatatccatctgagtgaccacttaatgcaggccggcatccttgagctgctccgggac gacaagaggacagtggtcttagtgacccacaagctacagtacctgccccatgcagactgg atcattgccatgaaggatggcaccatccagagggagggtaccctcaaggacttccagagg tctgaatgccagctctttgagcactggaagaccctcatgaaccgacaggaccaagagctg gagaaggagactgtcacagagagaaaagccacagagccaccccagggcctatctcgtgcc atgtcctcgagggatggccttctgcaggatgaggaagaggaggaagaggaggcagctgag agcgaggaggatgacaacctgtcgtccatgctgcaccagcgtgctgagatcccatggcga gcctgcgccaagtacctgtcctccgccggcatcctgctcctgtcgttgctggtcttctca cagctgctcaagcacatggtcctggtggccatcgactactggctggccaagtggaccgac agcgccctgaccctgacccctgcagccaggaactgctccctcagccaggagtgcaccctc gaccagactgtctatgccatggtgttcacggtgctctgcagcctgggcattgtgctgtgc ctcgtcacgtctgtcactgtggagtggacagggctgaaggtggccaagagactgcaccgc agcctgctaaaccggatcatcctagcccccatgaggttttttgagaccacgccccttggg agcatcctgaacagattttcatctgactgtaacaccatcgaccagcacatcccatccacg ctggagtgcctgagccgctccaccctgctctgtgtctcagccctggccgtcatctcctat gtcacacctgtgttcctcgtggccctcttgcccctggccatcgtgtgctacttcatccag aagtacttccgggtggcgtccagggacctgcagcagctggatgacaccacccagcttcca cttctctcacactttgccgaaaccgtagaaggactcaccaccatccgggccttcaggtat gaggcccggttccagcagaagcttctcgaatacacagactccaacaacattgcttccctc ttcctcacagctgccaacagatggctggaagtccgaatggagtacatcggtgcatgtgtg gtgctcatcgcagcggtgacctccatctccaactccctgcacagggagctctctgctggc ctggtgggcctgggccttacctacgccctaatggtctccaactacctcaactggatggtg aggaacctggcagacatggagctccagctgggggctgtgaagcgcatccatgggctcctg aaaaccgaggcagagagctacgaggggctcctggcaccatcgctgatcccaaagaactgg ccagaccaagggaagatccagatccagaacctgagcgtgcgctacgacagctccctgaag ccggtgctgaagcacgtcaatgccctcatcgcccctggacagaagatcgggatctgcggc cgcaccggcagtgggaagtcctccttctctcttgccttcttccgcatggtggacacgttc gaagggcacatcatcattgatggcattgacatcgccaaactgccgctgcacaccctgcgc tcacgcctctccatcatcctgcaggaccccgtcctcttcagcggcaccatccgatttaac ctggaccctgagaggaagtgctcagatagcacactgtgggaggccctggaaatcgcccag ctgaagctggtggtgaaggcactgccaggaggcctcgatgccatcatcacagaaggcggg gagaatttcagccagggacagaggcagctgttctgcctggcccgggccttcgtgaggaag accagcatcttcatcatggacgaggccacggcttccattgacatggccacggaaaacatc ctccaaaaggtggtgatgacagccttcgcagaccgcactgtggtcaccatcgcgcatcga gtgcacaccatcctgagtgcagacctggtgatcgtcctgaagcggggtgccatccttgag ttcgataagccagagaagctgctcagccggaaggacagcgtcttcgcctccttcgtccgt gcagacaagtgacctgccagagcccaagtgccatcccacattcggaccctgcccataccc ctgcctgggttttctaactgtaaatcacttgtaaataaatagatttgattatttcctaaa

Copyright © 2011 Insilicase.