Indel identification

Purpose of this page

This page is designed to disentangle a sequence from an electropherogram that contains an Indel. When extracting the sequence from the trace it is important to check that extra positions are not inserted in to the sequence. This is caused by the variation in speeds of different peaks from the two alleles and can amount to substantial displacement. The system works best with a total input sequence length of more than 50bp with at least 30bps of unambiguous sequence at the 5' end and 20 bases of ambiguous sequence at the 3' end. The reference sequence must be the expected sequence, which is assumed to represent one allele. Instructions and sample data is included at the bottom of this page.

A Windows program that duplicates this page can be downloaded here.

Reference sequence (maximum length is 500bp)

Ambiguous sequence (maximum length is 500bp)

Instructions and test data

Copy and paste the reference sequence to the 'Reference sequence' text box
(i.e. acgctgatcggatgctaggctgctatgcagaaaatcttagagtgtcccatctggtaa)

Then copy and paste the trace sequence to the 'Ambiguous sequence' text box
(i.e. acgctgatcggatgctaggctgctatgcagaaaatcttagwgtsycmymtskkrwrw)

Now press the Submit button