Site specific mutagenesis
Purpose of this page
When creating a cDNA clone by cloning RTPCR products it can be quicker and easier
to clone the ORF as smaller products and then add them together to create the full
length cDNA. To do this it may be necessary to insert RE sites in the primers that
amplify the products. These sites can then be used in the sub cloning, but must not change
the protein sequence.
This page allows you to identify restriction enzyme sites that can be introduced into an open reading frame
without changing the amino acid sequence. The page identifies sites that differ from the restriction site
by one nucleotide and then checks to see if the new site would change the protein sequence. Where the
sequence is changed the altered sequence is displayed next to the original one. When the original site
contains the enzyme site its position is also given.
A Windows program that duplicates this page
can be downloaded here.
Instructions
The sequence format
The first frame of the sequence is translated in to an amino acid, this means that the first base of the sequence must
be the first base of an amino acid codon. The maximum length of the sequence is limited to 66bp (22 codons). For a demo
sequence press .
Analysis
Enter the sequence in the first text box and press the 'Submit' button. The results are then displayed in the lower text box.
If a restriction site can not be introduced that site is ignored. If the site can be introduced and does not change the protein
sequence it is displayed like this
AatI, Eco147I, PceI, SseBI, StuI aggcct
cctgtcAGGCCTcagcatcatctgaattatgagtgtcgagcgctacctggc
cctgtccggcctcagcatcatctgaattatgagtgtcgagcgctacctggc No AA change |
Enzymes that cut the site The restriction site The new sequence The original sequence No protein change |
Where the amino acid sequence is changed the results look like this
Acc65I, Asp718I, KpnI ggtacc cctgtccggcctcagcatcatctgaattatgagtgtcgagcGGTACCtggc
cctgtccggcctcagcatcatctgaattatgagtgtcgagcgctacctggc P V R P Q H H L N Y E C R A V P G AA change
P V R P Q H H L N Y E C R A L P G |
Enzymes that cut the site
The restriction site The new sequence The original sequence
The altered AA sequence The original AA sequence |
Where the site is already present in the sequence the results look like this
BsiSI, HapII, HpaII, MspI ccgg (this site is also present in the sequence at bps 6) CCGGtccggcctcagcatcatctgaattatgagtgtcgagcgctacctggc
cctgtccggcctcagcatcatctgaattatgagtgtcgagcgctacctggc No AA change |
Enzymes that cut the site The restriction site and site(s) that are already present The new sequence The original sequence No protein change |
Where it is posible to introduce the site in multiple positions each possible site is listed.
|