Insilicase
deus ex computa
 
     Skip Navigation Links.

 

Site specific mutagenesis

Purpose of this page

When creating a cDNA clone by cloning RTPCR products it can be quicker and easier to clone the ORF as smaller products and then add them together to create the full length cDNA. To do this it may be necessary to insert RE sites in the primers that amplify the products. These sites can then be used in the sub cloning, but must not change the protein sequence.

This page allows you to identify restriction enzyme sites that can be introduced into an open reading frame without changing the amino acid sequence. The page identifies sites that differ from the restriction site by one nucleotide and then checks to see if the new site would change the protein sequence. Where the sequence is changed the altered sequence is displayed next to the original one. When the original site contains the enzyme site its position is also given.

insilicase icon A Windows program that duplicates this page can be downloaded here.

     

Instructions

The sequence format

The first frame of the sequence is translated in to an amino acid, this means that the first base of the sequence must be the first base of an amino acid codon. The maximum length of the sequence is limited to 66bp (22 codons). For a demo sequence press .

Analysis

Enter the sequence in the first text box and press the 'Submit' button. The results are then displayed in the lower text box. If a restriction site can not be introduced that site is ignored. If the site can be introduced and does not change the protein sequence it is displayed like this

AatI, Eco147I, PceI, SseBI, StuI
aggcct
cctgtcAGGCCTcagcatcatctgaattatgagtgtcgagcgctacctggc
cctgtccggcctcagcatcatctgaattatgagtgtcgagcgctacctggc
No AA change
Enzymes that cut the site
The restriction site
The new sequence
The original sequence
No protein change

Where the amino acid sequence is changed the results look like this

Acc65I, Asp718I, KpnI
ggtacc
cctgtccggcctcagcatcatctgaattatgagtgtcgagcGGTACCtggc
cctgtccggcctcagcatcatctgaattatgagtgtcgagcgctacctggc
P  V  R  P  Q  H  H  L  N  Y  E  C  R  A  V  P  G   AA change
P  V  R  P  Q  H  H  L  N  Y  E  C  R  A  L  P  G
Enzymes that cut the site
The restriction site
The new sequence
The original sequence
The altered AA sequence
The original AA sequence

Where the site is already present in the sequence the results look like this

BsiSI, HapII, HpaII, MspI
ccgg (this site is also present in the sequence at bps 6)
CCGGtccggcctcagcatcatctgaattatgagtgtcgagcgctacctggc
cctgtccggcctcagcatcatctgaattatgagtgtcgagcgctacctggc
No AA change
Enzymes that cut the site
The restriction site and site(s) that are already present
The new sequence
The original sequence
No protein change

Where it is posible to introduce the site in multiple positions each possible site is listed.



Copyright © 2011 Insilicase.

 

   
  54.225.47.124